CShisMan2_48


Sequence

>CShisMan2_48 (10 EST) Length=652 GAAATATCCTGTCCAAATGTATAACCAGCACCACGTGGACTGATACCCCAACCACCCCTGTCATCTGGATCGGACCACAA TAAATCACACATTGGACCCTCATGGGGAACCTCTTGAATCCTGTCCAAAGCTCTAATGTGATCGAGTGTATCTATCGAAG GTGACAGCCCACCATGTAAGCAAAATATTGAATTGTCAACGAGTGCAGTTAGTGGGAGATAATCAAACAAGTCGGTAAAG TATTTCCAAACATTAGCATTACCATACTTGCGAAGGCACTCGTCATAAAACCCATAAACTTGTGTGATCTGACGACTTTC GTGATTGCCCCGAAGGATAGTTATTCGGTCTTTGAACCTAACCTTCATGGCCACGAGTAAAGTGACAGTTTCAACAGAAT AGTACCCACGGTCAACATAATCACCCATGAATAAGTAATTGGTATTCGGAGACTTTCCTCCAATGCGAAATAATTCCATC ATATCATGAAACTGGCCATGTACATCACCACAAACAGTGACTGGGCTTCGTACATTTTGAACATTTGACTCCTTTGTGAG TATATCCTTAGCCTTTTCACAAAGGGACTTAACCTGTGCTTCTGTTAGCTGATTACATTCATACAGTTGCTCGATCCACT GGTCGCGTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_48: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100222330311AA559615MC080555.NA3TBRI-Saber-cercaria-A
18146253384985AI067018EST208686Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146943385054AI067087EST208757Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148193385179AI067212EST208886Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148403385200AI067233EST208907Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149013385261AI067294EST208971Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150513385411AI067444EST209126Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157453386105AI068138EST209828Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158463386206AI068239EST209930Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158473386207AI068240EST209931Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:48:34 on Wed 22 Nov 117.