CShisMan2_483


Sequence

>CShisMan2_483 (2 EST) Length=444 AGACAATCAATAAAGAAGGTAAATGTAGCAATGAAAGAATGGAACAATTATATACACAATTTTTTTTGGTTTTGATAAAA GAAGAAAGACTTTTTAATTCACCCATTACTGATGTAAAAAAAAACGAGCAAACAATCACTAGTTCATCATGGATGATGTA ACAATTATTGAATAAACTAAAAAATATTAGTGAAAGACAATACAATAATTGACAATCATCCACAATTATAATCATGTACT GTACAAAAAGAGAAGGAGAATTACATTACAACATTTTAACTCTCACATACCAACAAACTATTATTATTGCATTATTTATC CATAGTACTAAGAGTTGATTGAATAGTAATGGCTTTTTTATTCTTTTTCGTAGATAAAGCAGCTATAATCCATTTCATAT GGATAAGCATCATTTTTAAAGCTTTAGTCCAATTTTCTTCAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_483: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191231127974N21841SMNHADA018055SKSmAW
5137231444976W06756SMEST0392Schistosoma mansoni, adult worm, Gloria Franco


Date: 22:13:2 on Sat 18 Nov 117.