CShisMan2_486


Sequence

>CShisMan2_486 (2 EST) Length=444 TTTTAGTGCANNGGCCCGCCAGCTGAATGAATGGCATCATCCATTAACATCTTGAAAAGCCGACTCTGGTTCTTCGTCTC AGTACTTTTTTAAAACGTTGGAAAACCCGCATGGCTAGTTCTTTATGGGAATGGTGAACTGCGATACTTTGAAAAGTAAG GATGATTATGNTAGCGAAAAGCGAACTATTAATGTTTCCACGAGTTTGCAGGGAAAATTCTGTTCTGGTCATCCAAAATA TCGAATCCACCTAAAGATCGTTCTAGCGAGTGCCATTTTCGGCCTCAGGGACAGCATGAAATCCTGGACTGGGTATTTCT GGCGCCCCAGTTCCACCCTGAATGAATGCCAGTGGAATATGGGCGCTCCTTGGCCTNTTANTCCTGCAAGGTTTAAAAAG GGAANTGTTCCCATCCCCCNCCGTTTTTATTCGAAGTTTCCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_486: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097342330023AA559818MU001001.NH3York-Harrop-lung-A
17369373189857AA999302MCCE3114.M1FSchistosoma mansoni, cercariae


Date: 13:29:42 on Thu 23 Nov 117.