CShisMan2_491


Sequence

>CShisMan2_491 (6 EST) Length=913 CCGAATCAAAGGGTGACTCAGTGGATGCTAAATCTGATTCAGCTAAACTTCCAGNAAAATGAATCCAATGGTGCATCAAA TTCATCGGAAGTGACCGGAAATGAAACTTAAACCTACGACAACGAACTAATGTATTTCATCAATATTTTTAATACCCACG TTTCATTATGTTTAGCTTATGATTAATGGCCACTTGCAAATGAGTATGTGGTTATTATGTTTGTTGGTTTTTTTCTCTCT CTCACGCGTACGTATGTCATGTAGATGATTATCTCATCATGGTCACAAACTATCATGTTTTTTTAATGGTTGTAATAGAT CCTAATATTTTTATGTGGCAAAATAGCCTTATATATATTTTATAAAGCTTAAATAACAAATAATTTGTTCCTTTTGTTCT TTCCACTGCTTAGCATATACGTTGAATATATATATTTATTTATTTGCATATTATGTGTACTTGCCATCAAAATTACCCCC ACCCCAACAAATTTAAGGGTTCTAAACATAAGGAAATCTAGGAACAGGGTGAATATTCAAGGAATAAACCATCATATCAT GATCATTGATATAAGTAAAATGAAAAAGAATTTGGAACCGTTAACATTTCAATTCGATCAATAATTTAAGGATAATCATA AACATACATATGAATATTGATCAACTATAAAAAGGAGGAAAATGAATGAGAGAAATAGTTGCCAAGCATTCATATCATAT AAGCAGTATATATGTATATATATTGAATTCATTTAAGGAGCTGATCAGGTAAGGATAGAAAATGCTTAGTAACAAGATAA AGTTATATTATAATTAGTTTGCCAGTAAGTTCTCCAAAAGTTGAATCCAATTCTTCCNCTGAGTGCTTTATATTTCTCTT TNCTCGGTGACCAATTCATCTTCNAGGCGATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_491: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39403514797T14630SMEST0291Schistosoma mansoni, adult worm, Gloria Franco
344445972846L46978SCMRAP065C2/tcz2 adult worm mini-library
345058981325R95665SMNHADA008063SKSmAW
5137261444979W06759SMEST0395Schistosoma mansoni, adult worm, Gloria Franco
5137281444981W06761SMEST0397Schistosoma mansoni, adult worm, Gloria Franco
5137821445035W06815SMEST0451Schistosoma mansoni, adult worm, Gloria Franco


Date: 15:12:0 on Wed 22 Nov 117.