CShisMan2_492


Sequence

>CShisMan2_492 (13 EST) Length=995 GCACGAGATCTTCCAGTATTTTAAAGTGATCGGAGAATGAAAAGTGGCTGGGAGTATATTGGAATCTTTTTGTACATTAT GGTGAATATTCTGGATAAACAACGATGTCATTCAGTGCGTTGCTACGTCTGTGATTATTGTCCGATAGTAACAAGCGTAT CAATATCAGAAGAGAACAACTGTACATCTTGCTCAACGGCTGGTTATAATTATTCGATTCACAGAATATGCGTGTTTGAG AATGGCATACCCATTAACTTCCCAAACGAAAATCGAACGCAGTGAAACACTGATTTGTGTAACGGGTTAACAGTTGATAA CACTGGAAAAATTCCATCAGTTCCTATAGCAAATCCATTTCGTTGCTATACGTGTTTGAATTGTACAAAAAGTAACCAAA AGGTACTTAGCGGTTGTGGTGCATGTGTGACAACTCGTGGTTCTGGAATTATCAGTAAATTTTGTGGAACTACATGTGAA AGATTGTATATTGACGATCAAATTAGTTGTTGCTCAACAGATCTATGTAACGGAATGACAAAATTATCTATTCATCGTCA TGTTATTATTGTTCTGTTTGTTTGCATAGGAATCAGTAAATACATTCTATGAATGACTAAGCCCATAATCTTCTGTGATT TATATACTTGCTTTGAATTTATATACATTTTGGTCATTTTAATTGAAATCTATTCATTATTAAACACTCTACCTTCTTCC ATACACATTCACATATTAAATTTGTTGTTTCTTGAAATAGTTCACTATGTACTACATATATCGTTCTATTTGTAATAAAT TTATAGTTTGAACGTAGGCTNAAGGGGAAGACATACATGAACCCAAATGCAAGTGTTGAGGATATGTTTAGTTTTGCCTG TGTGTATAAATCTTAATGATNACAGATCTGNCCAGAAGACCAGTAAGTTTATTTATATATAATCATCTCAANTANCATTG TAAATAGTAAAAAATAAGTCACAAATCCACATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_492: (13 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344807974664L47067SCMRAP154C2/25RY adult worm mini-library
4191221127973N21840SMNHADA018051SKSmAW
8247851769636AA185822MAAD0102.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247951769646AA185832MAAD0115.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248091769660AA185818MAAD0133.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248241769675AA185759MAAD0167.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248531769704AA185788MAAD0215.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248671769718AA185802MAAD0236.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529432245778AA508338MAAD0370.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529452245780AA508340MAAD0365.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529502245785AA508269MAAD0355.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529552245790AA508274MAAD0346.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529732245808AA508292MAAD0304.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 1:10:32 on Mon 20 Nov 117.