CShisMan2_494


Sequence

>CShisMan2_494 (4 EST) Length=914 ACCAGCGCAAAAAGATTGCCGGGAAACATGCTTCGCTGTGTTTGGAAAAGGTGTCTTTGCTGCATCATCAACCATTTAGA TTCAGCAAAAAATTACCTGCTGGGCAACGTTTAAGAATTGGCTACGTTAGCTCTGATTTTNGCAATCATCCGACCAGTCA TTTGATGCAAAGTATCCCAGGTCTACATGATCGAACTAAAGTCGAGGTGTTCTGTTACTCACTTGCACCTGACGATGGCA CCAATTTCAGAGCTAAAGTCGCAAATGAAGCTGAACACTTCGTCGATCTAAGTGGGATTCAGTGTCATGGNAAAGCTGCA GATAAAATTGCAAGCGATGGAATTCATATTCTCCTAAATATGAATGGCTTATACGGAAGGTGCACGTAATGAAATATTTC GCACTGGAAGCCTGCACCAATCCAAGCTATGTGGCTGGGGTATCCTAGCACAAGTGGTTCGACATTTTATGGATTATATC ATCACGGACATGGTAACATCTCCCATGCACTTAAGCCATCAATACTCTGAAAAGTTGGCATACATGCCCAAGACGTTCTT TATTGGGGATCATCAACAGATGTTTCCTCATTTACGCAACCGGGTTATTCTGGAGAGTGCTGAAGATGCCGCCGCAGGAC GCCGTGTAACAGATAATTCTATCGTTGTCAGTGGTTTAGATATCAAACCCCTGCTNACAAGTTGCTTGTGTGCGTGAAGT CACTTTACGGAGGTCGCTTGGTTGGAGATTCATGGCAGCCAACGTAAAGATGTTTCTTAACTTNCACAAAGCTCACCGTG TTAACGATTCCCTCTTTACAGCCTATACAAAACATGATTCGTACAAACAGTCCGTCTTGTACTATTAATGGCGTAACTAT TCATAATGGTTTGGTGACACAACAAACACAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_494: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39161514555T14388SMEST0049Schistosoma mansoni, adult worm, Gloria Franco
39306514700T14533SMEST0194Schistosoma mansoni, adult worm, Gloria Franco
39326514720T14553SMEST0214Schistosoma mansoni, adult worm, Gloria Franco
39364514758T14591SMEST0252Schistosoma mansoni, adult worm, Gloria Franco


Date: 18:46:43 on Thu 23 Nov 117.