CShisMan2_495


Sequence

>CShisMan2_495 (2 EST) Length=446 AACTATAGATTAGATTAATTTATTTGATTAAAAATGATTACGTATGTAATACGTGAATAATCAACAAAGAAAATATTTTT TTAATTGAGGTTCATTTTAAAAATACAGCAGAGACCAAGCATAGTGTGTAGTGCAGTTGAAAATGAGACCAAAAAAATCT GTATCAATAAATGATGAGAAGCAAGGACCAAAATTTATCACTTCTTTTTNAAGTTTTTCAAAACGTTCTGCCAGAGTGTC AAAATCTGCTTTTTCATCATCTAGAGGAGGATTACTAGGTCCATTCATTGGTGGCATCATAGCGAACTACCCTGGAGGAA GTGTTGTGAAACTATCTTGAGATGGTAGAAAAGATGGACCAGGATAATTAAATGGTACGACAGCATTTTGACCATTGCAT ACAGACATATCATATGGCGGTGGCATAGCGTATCTTCATTGGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_495: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39402514796T14629SMEST0290Schistosoma mansoni, adult worm, Gloria Franco
5137221444975W06755SMEST0391Schistosoma mansoni, adult worm, Gloria Franco


Date: 14:13:33 on Mon 20 Nov 117.