CShisMan2_496


Sequence

>CShisMan2_496 (5 EST) Length=442 GATGAAGTTGTCCGTCGCTCTTGTTGTTGTTTTCCTTGTTTTCGCTGCGTCAGAGGTCACTGAGGAAGATGATGTACTTG TATTAAATAAAAAGAACTTTGATGACGTTATCAAGACCAATAAGTTTGTTTTGGTTGAGTTCTATGCTCCTTGGTGTGGT CACTGTAAGGCTCTTGCCCCAGAATACAGTGAAGCAGCCAAAAAATTAAAGGAAAAAGGTTCGCTAATCAAACTTGCTAA AGTGGATGCTACCGTCGAAGAAGAACTTGCTTTCAAACATGGTGTCAAGGGATATCCGACTTTAAAGTTCTTCCGAAACG AACAACCTATCGATTTTGGGGGTGAAAGAGACTCCGATGCAATCGTAAACTGGTGCTTAAGAAAATCCAAACCTTCCGTG GAATATATTGATTCATTAGATAGTTGTAAACAATTTATCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_496: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149203385280AI067313EST208991Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150793385439AI067472EST209154Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152733385633AI067666EST209349Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154653385825AI067858EST209542Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159073386267AI068300EST209991Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:40:23 on Sat 18 Nov 117.