CShisMan2_497


Sequence

>CShisMan2_497 (3 EST) Length=442 GTTACTTGAATAGTGTATTTAGTAAAGAATAATATGATAAAAAATGAAATTTGACCTAAGAAAATGTTCAGTTCAAAAAA ACTGGTGCTGTAGCACAATTATCGATATAATCATGAACAATTTAAGAATGGAAGCAGTAATCTTATCATAATGAAACAAA CAAAATGCACTATTTCGTTTGTTAGTTTCGGTTTAAATGAGAAAACAACATATGGGTGGAAATAACAACTGATAAATGAG TGATTTACAGGTGAATTTTTCTCATTATCATCACACAAAATAATGTAGATGATCTAATTCTTGAAAGAACAGTATATGAA GACTTGTTTGAGTGCGCACTACATTTGAGACCCATCGGCAGCAGTAGCGATATTTTCTGGTCCAAGTAGAGAATTATTTC CAGACCATGGAGTTTCTTTCCATATGAACCATAAACCAGCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_497: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137051444958W06738SMEST0374Schistosoma mansoni, adult worm, Gloria Franco
5137761445029W06809SMEST0445Schistosoma mansoni, adult worm, Gloria Franco
15129992854279AA791324SMTBADA000720SKSchistosoma Lambda Zap II


Date: 10:29:2 on Mon 20 Nov 117.