CShisMan2_498


Sequence

>CShisMan2_498 (3 EST) Length=444 GCACGAGAGAAGATCAAGGAAATCGTTCATCATGAACCTGAAGTGCCAGTCATTAAAAAAGGGAAGCCTTCAAAAGTTGC CCCGCTTCCTGAAATAGCAAAGAAAACTGTCGCTAAGAAGAAGGTTGTCAAAAATCCGTTAATCCAGCGCCGACCTAAAA ATTTCGGAATCGGACAAGATATTCAGCCGAAAAGAAACCTTTATCGTTTCGCTAAGTGGCCGAAATACATCGAACTTCAA AGAAAGAAAGCCATCCTGAAAAAGCGATTGAAGATCCCACCCCCGATCCATCAGTTTTCTCAGACATTAGATAGGAATTC AGCTGGTCAAATATTCAACTTAGTTACCAAGTACCAGCCCCTGAGCAAGGAAGCTAAGAGGATGCTTCTCGTTCATCGAG CACAGTTGCGTGCTGAAGGCAAACCTGATGAACCATCATCACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_498: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39204514598T14431SMEST0092Schistosoma mansoni, adult worm, Gloria Franco
18150723385432AI067465EST209147Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157273386087AI068120EST209810Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:42:50 on Fri 17 Nov 117.