CShisMan2_50


Sequence

>CShisMan2_50 (12 EST) Length=644 GCACGAGATCTTATCTCCGTTATCTCTCGACATTTAACTTATTACATTATTAAAATGTAGCTGTGATTCCGTGAGTTTTG TTTCGTTTCTCAAAAAATGTTCTGATGTAGTTCGATTCCATCTGCCTATAACTGCTATAGATTTTGTTGAAATAGCGTTC TCTGAGCACGGCGGTTTAAAGATACACAATTAGATGATATCATTCTCTTGAGCAACTCCTTTGGTTATCAGTCATGATTA TACATTTAATAAAGTGAAAACAGGAAAGTTGTATATTGAAAAAAACCGTTTGTTTGCTTTTTCTTATTTAGTTTCTTCAA GATGACATTGTTAAGCTTCTAGGGAAATTTCCATCGACACAAAAGCCTATTAGATCTGCAGCACGACGCTTTTTAAACTT GTTGAAAGAGAACAATCGTAAATCGGGCGTGTTTAATGAATCTGAAAGTCGACAAGAAAGATTGCGTCTTAAAATGGAAC GCAAGAAACAACGTCAACAGAAGCGTAAAGAAAAAGCCTTAATGAAAAAGGAACCGACGAATAAAACAACTGGACCAAAA CGAAATGAAGTCAACGCGAAAAAGAAGTCTCTTAAGAATAATGCCAATAAATCTAAGCCAACGATTAAAACAGTGCCTTC AACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_50: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145853384945AI066978EST208643Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147533385113AI067146EST208817Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147563385116AI067149EST208820Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147903385150AI067183EST208855Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149443385304AI067337EST209015Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149593385319AI067352EST209030Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150703385430AI067463EST209145Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152883385648AI067681EST209364Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153203385680AI067713EST209396Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155043385864AI067897EST209584Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156653386025AI068058EST209747Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156793386039AI068072EST209761Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:48:58 on Fri 24 Nov 117.