CShisMan2_500


Sequence

>CShisMan2_500 (4 EST) Length=505 GCCCCCCTTAAGGACTGCNCAAGGTATACTCAGTACATCTCTGATACAATCTGTTAATAGCTTGATACCATGATCATCAC TCAGTGCCAACCCCTTCATTAAAGAAATAGCATAAGACGTTGGTTTGACAACAGGCTTCATTTCCGCCAATGTCCTATTA AGGAACTGATGGGGCATAACAATGATAAGTACGTCAGCATCTCGAGCTACTGATTTTACGTCTGGGTCAGCAACAACGTT TTCTGGAAGCTTCACATTGGGCAGATACTTCACGTTTTCGTGAGATGTGTTAATTATTTCTGTGAGTTTACGGCCATTGA CTAACTCCTCAAAAACCCACATACGAACCTCTGGAACATATTCGGGGAACTTTTTAATATTGTTACCAACTATTTTAGCA ATCGTTGACCCCCAGTTGCCTGATCCAATAACCGAAACACGTCTAAGAGACATGGTGCGCGATATCAGACGTCTGACGCG CAGCCTTCCTCAAAGCCTGCGAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_500: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824091713247AA143842MCCE0212.M1FSchistosoma mansoni, cercariae
12101482330437AA559741MC140312.NA3TBRI-Saber-cercaria-A
12165932338842AA566210MC3NE033.ACSS. mansoni cercarial Lambda Zap
15469532897574AA825096SMTBCEA000024SKSchistosoma Lambda Zap II cercariae


Date: 4:23:46 on Fri 24 Nov 117.