CShisMan2_506


Sequence

>CShisMan2_506 (2 EST) Length=440 AAAAAATTAATAACCTGCATTTGTATGTCTATGTCTCAAGCAAAATACAAATACCAGACAAAATAGTAATCAAAATTTTT GAACATTTAAGTCAGTAAGGTCGTTGAGTTCCCACACTGTCTTTGTTAAAATGCGACGTAGTTTTTCGAGTTCTTCTGTT ACTGTTAGTAACCTTTTGGTCACTTTCTCACGAGCTATAATTAGTTGCTTTAATTCAGGACTTGGTTCTTTGTTCTTTAT CGGGGTATCTATATAAGGGACAAGGTCAGAAATGTCAACAGGAAGTAAGCGGTCACAGCTTTCTTTTACTACATGAAAGG CCTGTTTAAGAAGTTCTTTGTTGCTTTTCATCTGCTGCAATGTTTCGACACATTGTGGTCCAGCGATAGATGCTTGGTGA GCACTCACTCCGCGGGGTTTTNGGGTTCCATGCACGCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_506: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641821685498AA125679MLLG0234.M1FSchistosoma mansoni, lung stage
7641831685499AA125680MLLG0235.M1FSchistosoma mansoni, lung stage


Date: 21:45:44 on Mon 20 Nov 117.