CShisMan2_508


Sequence

>CShisMan2_508 (3 EST) Length=473 AGANAGAAACCCAAGAAAGATACCAATTACTAATCCGAANATTAANACACCATTGATTGCTCCNACNACNACACCCATTG GGANNAAGTAATCCAAGACCATCTCGTGAGNCTAAAGTCATCTATTTTCTTTAGTGTGAATGAAGAGGTGAANTTACTTT TTCGTTNCNCGGTCGGCAGGCGCTATTTCCACCTATATAGTANTGCTCCATAATTTCGCGAGCATCTGATGAGTGTCCTA CATCCTCACACAATGGTNCGGTACCGTAATCCCCCGCNTGTTGTTCTAATACAGTTTCACCCCTGGATGCTCAGATGCGA ACTTTGTCAAGTCGTATACTTTATCGTGAATCACAATCCAAAGATCATCTGGCTTATTGTGTTTTCTGACATCTTCAAGA GTAAAAACCTTAACCTCAGACGACATCAAGGAGTCATGCGTTAATAACGGAAACTAGATAGATGGAAACTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_508: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344854975910R95540SMNHADA001046SKSmAW
9102191906284AA269216MA1MR039.AA3S. mansoni adult Lambda Zap
11587012252878AA514113MA2AS019.AASS. mansoni adult Lambda Zap


Date: 12:5:17 on Wed 22 Nov 117.