CShisMan2_51


Sequence

>CShisMan2_51 (3 EST) Length=649 AGAAAATATGTTAAGTGAAATGTNTGGATGAACTTTAAATAGGTGTATTGAGTCGACCACGGTTATTCAGACGAGATTTC CCTGAAGCTCGATGGTGAATCCGACGACGTGTACGCGACAGATGTGGTAGATTTTCAGGAGGTAGTACACGATAAATTCT TACAAGCCAATGTTTCGATGTAAAAGCTTCCTCTAAGTAGTCTAATTCAAAATTTTTACGACCGATTTCAGATCCTCTAG TACGATCAAATCCAAGTGGTGTTCGCATATCTAGGCGAACTTCACCAAACCGATAATAGCTTAATTTATACATTAAACAA TTGAGCATCGTCTCAGAAGCACTTTTATCTATACGATAATCACCTGTTGAAGTTAGAAAATCTCGTTCACGAATTTCATT AGGATGTTCACCGCCACCAATACGCACCATCCATAAGAATTTATTAATATCATCACCGCTGTAACCGATGTAACCGCCGA ATATGACCAGCACGTAATCCACGTCTAAACTTTGAATAGTTTTATAGGCTTCTGATTCATTTGATGCCATAGCCTTACCA ACTAATGCGATATGACTGTTATTCCATGTGTTATTATCAACTAGAGTAGTGCGGTTACCCATCCCTGCGATTTGATATCC ATCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_51: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145933384953AI066986EST208651Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153553385715AI067748EST209431Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155393385899AI067932EST209620Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:27:52 on Sun 19 Nov 117.