CShisMan2_513


Sequence

>CShisMan2_513 (2 EST) Length=464 TCAATATTTCATCAGTACTTCTTATTTAGTAAACATACACACAACAAGTGTTCAATAATGTTCATTAAAAGAATCATTGT TGACTTATTTTGGAGGAGCATCTCCACCACCAAAAGTACCAGACCAACCTTGCAGAGGCCATTTTATGTACCTGCTAGAA TTCAAGTAGTTCTTGATTGGTGGTAAATCTTCAATACACTGTTTTGAAAGATAACTAATTTTGGAAAATCATCCAAACAC TGTGAGTCCATGTATAAAACCACATCAAGAGCATCGTACAACATAAAGTCAGGATGAGTCACACAATCACCGTTCAAATA AGTATTGTGTAGACAAACGATCTTCAAACATTTTCAGCATCCCAGGAAGTTGGGTTGACAAAACCAACTTTGAGAGTTTC AAATTCCTTATTATATGCAATTCTTAAAACACCATATCTAATGTCCAAAACGCTCCTTCAAGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_513: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371333190053AA999498MCCE3400.M1FSchistosoma mansoni, cercariae
18158433386203AI068236EST209927Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:47:15 on Thu 23 Nov 117.