CShisMan2_515


Sequence

>CShisMan2_515 (2 EST) Length=439 ATTTGTGAAATATTTAGTTATATTTCATTTTCGAACGAAAAACCAAAACCGTCCTGCAATTCTATGCAATATTATGTGGA ATATTAAAAAGTACAGAGAATAAAAGTGAAGGTAAAAAGTTTAGAAAGACTTCTCAGTATTTTGTAAATAGTATAAAAGA AGAGTAAAAGAGTAAATGTTTTACGGATAGATTTCAAATGGGATTAAGTCAAGCTGAGTCGAAATTACAACGAATAAGTT ATTGCACTTTGATTATTACAATACATGATTTCTTCAGGAACGTTTTTGAAGGACTCCAAAATTTGAGTAAGTGAAGGACG ATCTTGAGGATTAGCGGACAGCATTGCTTCCATTAACTTTATCAATTCTGGTGGAACACTGAAAAATTAAATGAAGGAGA GGAAAAANNTGTTTTATGGAATGCTACACAATAGTAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_515: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8577991832559AA218466MAAD0125.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
17369803189900AA999345MCCE3171.M1FSchistosoma mansoni, cercariae


Date: 15:22:54 on Thu 23 Nov 117.