CShisMan2_518


Sequence

>CShisMan2_518 (7 EST) Length=599 GAATATGAAAAAGCTGCTTTATGCAGAATAGTTAGTATGCGTGTAAAATAACAATGACTTGAAGTCTACATTAAATGCGA TTACTCATCATAATCACCTTCTCGAATCTCATGGGCACCGTTGCTCCTTCCGTCCATTTCCTCGTCAGAACGTCTAGGCG TCCCAGACTCACTACGATGCGACATTGAACGCGATCGTGATGCGGACCGAGAGTGTGTATGCGACCGACCAGGAGACCTC GATTCCACTGAACGTGACCTACTTCCAGACCTAGAATGTGAGATAGAACGTGACCTCGAACGCCGATCCAGATCATTTTT TATGCTATTCTCCCTACCATTGCAGCTCGGGGAACGGGAACCAGCATCCAAAGAGCGCTTGTTGCTGAGATGAGAATTGG ATCTTGCATTGGAACGGTTTGTCCCGGAACGGCGTGATGGANTTNTAGACCGTGGGTCATTAGAATTTTCTTTGGAGCGC CTGTGCGAATCGTTGCCGGATTCAGATCTTTGTCTATCACTTGAAAGTGACCTATCATGTCGATGCCGAGGACTTCTAGA CTTTTGCCTGCGATGAGAGTCTCGACTTCGTGAACGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_518: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39238514632T14465SMEST0126Schistosoma mansoni, adult worm, Gloria Franco
39397514791T14624SMEST0285Schistosoma mansoni, adult worm, Gloria Franco
5137071444960W06740SMEST0376Schistosoma mansoni, adult worm, Gloria Franco
12099362330225AA559529MC070518.NA3TBRI-Saber-cercaria-A
17581233233302AI018966SMEST0606Schistosoma mansoni, adult worm, Gloria Franco
17581563233335AI018999SMEST0639Schistosoma mansoni, adult worm, Gloria Franco
17581713233350AI019014SMEST0654Schistosoma mansoni, adult worm, Gloria Franco


Date: 22:7:19 on Fri 17 Nov 117.