CShisMan2_52


Sequence

>CShisMan2_52 (2 EST) Length=648 GAATCAGCATTCGCTGTAGCCGGAGTAACTCACGCCAACCAGGAGAAAAACCAGTACTTTCTTCAGTTGGTGGACCTATT GGCTCTCGTACGTGAGACACATGAATACTATTGTTGCTAAAACAATCCAGACGACGTAGAAATGTTTTGCGAATGGGATC AACTTTATCATCAGCAACATCCTTGGGATTGGTGGTATTGGGGACAGTCTTATGTTCGGGTTGGTTTTTAATTAGTTTTT TATTGCCATGACACCAAAAGGTATGCATAGATTTTCCCCCAGTGAGAGCGAGATAAATTAATTGCTTTTAATGCATCAGG TCGATTAGGGAATTCAACAACAGCACAGATTTTGACACCGAGTTGACTATGTAGTATTTGTGAACGTTTAAGATCAGATG GTATCTTGCGGTTTGGAAACAGAACACGCACTAAAGATGACTTGACTAAATTTAGAAGGTACTGGTCTTTTAAAATATTT GCGTCCGAGAAATAGAATTCACATTGTTTGATAATCTTTTCATTCATAAGCTCTGATTTCGGCTCACTGCATACAGCAAT ATTTTCTTTATCCTGCAGCACCGGACAATCAGAAAACCCACTGGGACCCAACTCCATCAGATGGTGTCCACTCCGCCAAA CCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_52: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147763385136AI067169EST208841Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158193386179AI068212EST209903Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:41:54 on Sat 25 Nov 117.