CShisMan2_520


Sequence

>CShisMan2_520 (2 EST) Length=454 TGGAACACCGCGTGCCCGGCCAATCTAGAACTAGTGGATCCCCCGGGGTGNAGGAATTCGGAACGAGGGTAATTTGGCTG GNNNAAAATTTTGGATAATTAGGTGTTCAACTGTGGTTGATTTTTGGGATGATAGATTTATTAAAAATATTAAAAGGTAT AGTCAATTGTGGTAGAAAAGTAATAGGATTTATAGGGTTACCTTCCCTTGGTTTCTTAGCGTTATAGCCCATACTCCCAT AGGCCTTTTAGCATTATAGTCTATAGTCCCCTCGGTTTCTTAGTGCTTATAGCCCATACTCCTTTAGTCTTTTAGTATTA TCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTACGGTAG GTGGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAACATGCCATGCAGCTGCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_520: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4071561119162H98277SMNHADA015073T3SmAW
18152273385587AI067620EST209302Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:40:47 on Mon 20 Nov 117.