CShisMan2_522


Sequence

>CShisMan2_522 (2 EST) Length=436 CAATACAAGTTCATTATAATTATTATAACAAATGGCAAGAAAATACAATTAATAAAAGTTGATAAACTTTCCCAAACGAC GATATTTGATGATAGTAATATATACTGTTTTTCACTAGTGAATGACTTTGAGATGGGAAAGCAAGTATGGGTAAAACATA AGCGTACAAACACAAAAAAATGATCAATAAAAAATATGAAAAAAGCTGTTTCAAAATAATCTGGAATTACATAACCTATG TACAGGTACTAAAATGAGATAATTATGCATATTATCAAATGCAAAGAAACGAAATTTTGGAAGCAGTAGTTCAAGAACCA TTCGCATCTGTAGCTGTCATGGAATCGTCATTGTCTGAAGTCAGAGGAATGAATTCCGGAGGAGGATATACGTTGCGTAG TGAACCAGCTGGAGCAGCANCAGGACCAGGATAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_522: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146063384966AI066999EST208665Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154073385767AI067800EST209484Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 21:36:32 on Fri 24 Nov 117.