CShisMan2_524


Sequence

>CShisMan2_524 (21 EST) Length=596 AAAGAAGGGGGTCAAAGATAAGTTTATTTCAGGGTTTTATTGCACGACAAGATTACGAATAAATATTACATAATTATTTG CCTCACAATATAACTTAGAAGCATTTACGGTGAACAATACCCGGACCAGATTCATCATATTCTTGTTTGGAAATCCACAT CTGTTGGAATGTAGACAATGACGCCAAAATAGAACCACCAATCCAAACGGAATATTTACGCTCAGGTGGAGCAACTATCT TGATCTTCATTGTGCTCGGTGCCAATGCTGTGATCTCTTTCTGCATACGATCAGCAATACCTGGGAACATTGTCGTACCA CCTGACAACACAGTGTTCGCGTACAGATCTTTACGAATGTCCACATCACACTTCATGATTGAGTTGAATGTGGTCTCATG AACACCAGCAGATTCCATACCCAAGAAACTTGGTTGGAATAACGCCTCAGGACAACGGAATCGTTCGTTACCGATCGTGA TCACCTGACCATCAGGCAGTTCATAACTCTTCTCCAGAGATGAGCTGGATGCGNCAGTGGCCATTTCCTGTTCAAAGTCA AGAGCCACATAACACAGTTTCTCCTTGATGTCACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_524: (21 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39138514532T14365SMEST0026Schistosoma mansoni, adult worm, Gloria Franco
39339514733T14566SMEST0227Schistosoma mansoni, adult worm, Gloria Franco
39391514785T14618SMEST0279Schistosoma mansoni, adult worm, Gloria Franco
8577971832557AA218464MAAD0123.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529072245742AA508302MAAD0468.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529182245753AA508313MAAD0431.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12097532330042AA559837MU001041.NH3York-Harrop-lung-A
12165612338810AA566178MA3MARO8.AA3S. mansoni adult Lambda Zap
16629103080335AA931026SMTBADA0001895SKSchistosoma Lambda Zap II
17580533233232AI018896SMEST0536Schistosoma mansoni, adult worm, Gloria Franco
17580633233242AI018906SMEST0546Schistosoma mansoni, adult worm, Gloria Franco
17580733233252AI018916SMEST0556Schistosoma mansoni, adult worm, Gloria Franco
17580893233268AI018932SMEST0572Schistosoma mansoni, adult worm, Gloria Franco
17580903233269AI018933SMEST0573Schistosoma mansoni, adult worm, Gloria Franco
17581243233303AI018967SMEST0607Schistosoma mansoni, adult worm, Gloria Franco
17581273233306AI018970SMEST0610Schistosoma mansoni, adult worm, Gloria Franco
17581303233309AI018973SMEST0613Schistosoma mansoni, adult worm, Gloria Franco
17581403233319AI018983SMEST0623Schistosoma mansoni, adult worm, Gloria Franco
17581453233324AI018988SMEST0628Schistosoma mansoni, adult worm, Gloria Franco
17581543233333AI018997SMEST0637Schistosoma mansoni, adult worm, Gloria Franco
17581793233358AI019022SMEST0662Schistosoma mansoni, adult worm, Gloria Franco


Date: 10:56:49 on Tue 21 Nov 117.