CShisMan2_527


Sequence

>CShisMan2_527 (23 EST) Length=559 GAAAATTTATAGATTTGATAATAAATTTTTCTTGTAAGGGGGTACCCTTACAGGATTTTCAAATTTTCCTTTTATTGTTT AAAATTAGGTATCAATTGGGGTAATTTTACTTGAGAAAATTTTTGATAATTAGGTGTTCAACTGTGGTTGATTTTTTGGG TGATAGATTTGTTAAAAATATTAAAAGGTATAGTCAATTGTGGTAGAAAAGTAATAGGATTTATAGGGTTACCTTCCCTT GGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTGTTATAGTCTGTAGTCCCTTGGTTTCTTAGTGTTATAG CCCATACTCCTTTAGTCTTTTAGTGTTATAGTCTGTAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCT TTTAGTGTTATAGTCTGTAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTGTTATAGTCTGT AGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTGTTATAGTCTGTAGTATGGTAGGTGGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_527: (23 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343547973951R95221SMNHADA002017SKSmAW
344656975521R95412SMNHADA009040SKSmAW
344661975526R95417SMNHADA009056M13SmAW
344669975534R95425SMNHADA009094SKSmAW
344857975913R95543SMNHADA002036SKSmAW
344863975919R95549SMNHADA007026SKSmAW
344867975923R95553SMNHADA007033SKSmAW
344886975942R95572SMNHADA008032SKSmAW
344892975948R95578SMNHADA008084SKSmAW
344933975989R95504SMNHADA018001SKSmAW
344955976011R95526SMNHADA018059SKSmAW
345016981283R95623SMNHADA019008SKSmAW
4071811119187H98302SMNHADA016045T3SmAW
4291691145895N28039EST000172S. mansoni cDNA
4291711145897N28041EST000224S. mansoni cDNA
7823831713221AA143816MCCE0111.M1FSchistosoma mansoni, cercariae
9102111906276AA269208MA1MR056.AA3S. mansoni adult Lambda Zap
12098342330123AA559427MC250441.NA3TBRI-Saber-cercaria-A
12098672330156AA559460MC260455.NA3TBRI-Saber-cercaria-A
12099312330220AA559524MC070512.NA3TBRI-Saber-cercaria-A
12102182330507AA559811MC250483.NA3TBRI-Saber-cercaria-A
15130422854322AA791367SMTBADA000923SKSchistosoma Lambda Zap II
16716313098718AA938819SMTBADA000263SKSchistosoma Lambda Zap II


Date: 1:42:44 on Sun 19 Nov 117.