CShisMan2_53


Sequence

>CShisMan2_53 (5 EST) Length=639 GGGAAGCTGAAAGATTAGCTGATCCGAAAGCACAAAGCGTTGTGGATGCTATACGAGAAACCTATAATGAGAAACCTTGG CTTATCTTTGTAGTTGGCCTTGTTTGTACATTACCCATTATTTTATGCTGCATCTACATGTGCCGGTCACCATCCAAACA ACACGATATTGGTATGCGCAAGAAGACTGATACATCCACACCAGACGACTCTCATCTACATGTTGGTGAAAGAAATGCAG AAACTGAAGAATTAGAAGAGTCTGGCGAAGAAGATATCGTTCAAGTTTCTAAAGGCTCCGGCGATGAATCAACCGCAAAT AAAACAGGGAGCAGCAGAGATAACTCGGCAGAGGAAACTCCTGATGAATCTGGAGAAACCGAGAAAGCTTCGGCTGCAAA ACAGTCTATTAGAAAACGACGTTCACGAAAAGAATAAACTTACTCCCTTGGATTTCATTCCTGAAACATTTGTTCGTATA GCTTATTTAATCCTAAACCTTACAAGCGTGTTTTCTTTGGATTGGTGAGATCGTAATTATCATCTCTCCCGTCATGTTAT TTGTTACTGTAGTTTTGTGTCTCTTTTGTGGAGACGGTTCATGTCTGTCTATCTACTTACTGTGACCTTCGATATATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CShisMan2_53: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146203384980AI067013EST208681Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148243385184AI067217EST208891Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151123385472AI067505EST209187Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156283385988AI068021EST209710Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158313386191AI068224EST209915Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:3:54 on Fri 17 Nov 117.