CShisMan2_531


Sequence

>CShisMan2_531 (2 EST) Length=432 GCACGAGCTATGCTCCTCCACGAGTGGTAACAGGCGTAAGTACCTCTAGAAGAACCCTTCCACAGTGTGAGCAACCGGGA AGTGATAACAGCCCTCATACCTCTAACACCACTCAAGATCTGGTCCTACGTTGTAGCTGACTGATTGATATGTGCCATAA TTTCCCCCCTATCATCATTTTCTATGTATTTGTTTTGTTCTGTATTCCAGTTTCCGAGTAAGAAAAGAATAACTTGACTA ATTAATACGAAAACGTTTCCTAGCATTGGTTATGTATATATATAGAAAATGTAAAACAGTTGGAAGGAATTAAAATCCTA TTGTACATTTTTTATTATCATTTAATGACAATCATAAAAAATAAACTATCCTTCCAGTTTATGACTGTTACTATTAGCTT CTATAGATGATTTTATGGCTTAATTTACCTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_531: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148003385160AI067193EST208867Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149413385301AI067334EST209012Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 11:47:42 on Fri 24 Nov 117.