CShisMan2_532


Sequence

>CShisMan2_532 (4 EST) Length=433 GAGATAATTAAAGGATCTATTTATTACACACAAAAACTAAAAGCATTTGCGATGAACAATACCGGGACCAGATTCATCAT ACTCCTGTTTAGAAATCCACATCTGTTGGAATGTTGATAATGAAGCCAAAATAGAACCACCAATCCATACTGAGTACTTC CGTTCAGGTGGTGCAACGATCTTTATCTTCATTGTACTGGGGGCTAGAGCACTAATCTCCTTCTGCATACGGTCAGCAAT ACCAGGATACATNGTACTTCCACCAGACAACACGGTGTTCGAATACAAGATCTTTACGGATATCCACATCACACTTTCAT AATCGAATTGTAAGTAGTCTCATGAATTCCCGATGCTTCCATTCCCAAAAAGCTAGGTTGGAAAAGAGCTTCTGGACATC TGAATCGCTCATTACCAATCGTGATAACTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_532: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369633189883AA999328MCCE3144.M1FSchistosoma mansoni, cercariae
17581583233337AI019001SMEST0641Schistosoma mansoni, adult worm, Gloria Franco
17609543237175AI021763ME0032.R1RSchistosoma mansoni, egg stage
17609613237182AI021770ME0107.R1RSchistosoma mansoni, egg stage


Date: 8:47:19 on Mon 20 Nov 117.