CShisMan2_539


Sequence

>CShisMan2_539 (3 EST) Length=455 ATCCAATATNAAANCGATTATCTTTACTGAAACAGCCATTTAGCTGAGAANCTTCAGTCAGTTNTCTTTTTTATAATTTA AGCAGGAAGACTGANGAAGCCNACCAGGGTAAGGTATANGGNAATAAAATGANAGAAAAATTAATTATTTGTATTTCCTT TTTAAGGGTATGCATCTCTATCTGTTTTGTAAAGATGCTAATCCTTCATAATAGAGACTATTCAATCTATTTACGATAGT AATACATTGGGACACAGAAAGGTAAACAGAAGGGGAAATGAAGGGAAAAGGCGTGAGTAATATGGTTTATTATATGATGT AATGCCATCAGTAACAGTGTTAGCAATAATTTTATATAAATAGAAAGTTTAATATCTAATTACATCAAGCAAATGAATGA ACATATTATAACCACGGGTTATTATGGCACTGCAGGTTTAATTGGAACAGTAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_539: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180571125946N20774SMNHADA008047SKSmAW
11587422252919AA514063MA2MA127.AA3S. mansoni adult Lambda Zap
15259472873404AA804156SMTBADA000945SKSchistosoma Lambda Zap II


Date: 12:30:17 on Fri 17 Nov 117.