CShisMan2_540


Sequence

>CShisMan2_540 (4 EST) Length=496 GGACGTTCATCCCGAATTCACTAAAATTTAAATTGATCACTGTTGGACTACATAATGAATTATGTGCATCATCTGTATTC GGTAAACTAGTAGTAGTGACATTAATAGTTTTAGGTCGTAAATCTTCTGAACTTTTTGTATATACAGATTTATAATGTAT ATCATCATTATTTGAAAATGAAGTAGGTCTGGAACGTTGAAAATCTCCACTACGTATTGAACCAGTTCTAGAGCGTTCAT CTTCGTTTATTAAAGAGTGTCCTTCAGGTGCATATGGTGTATGATCCCAGTAACATTTGCATCTTTCTGATAATCCTAGA CTTTCTCTAAATGATCGTCTATGACTTGATCTAATTGAATTACGATCCAATGAATACATACTTTCATGCNACAAATCACT CTCTCTCTCTCTCTCTCTCTCTCTCTCTCCAAAAACATTAAANCCATGNGACCCGATCAACTTNTCTATTCGAATTTTAN GGGATGCTGTNAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_540: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12098142330103AA559407MC250419.NA3TBRI-Saber-cercaria-A
12100632330352AA559656MC240726.NA3TBRI-Saber-cercaria-A
12101902330479AA559783MC210271.NA3TBRI-Saber-cercaria-A
17368503189770AA999215MCCE0233.M1RSchistosoma mansoni, cercariae


Date: 16:35:45 on Sat 18 Nov 117.