CShisMan2_542


Sequence

>CShisMan2_542 (2 EST) Length=378 AGNATNTNAAGTTGAATACTTAAATTTAACNTTGCATAGTAATNACTGATAGATTAGTTAAACCANATAAATAATTCANC CAATTATAAATTACTCTTAAATATAGTACTCTCTTTTTGTTATCANAACTAATCGGTTGGAGATNTTAAGACCTATTCAC CTTTTTTGAAGGATATGAATAAAATAACAAACAGTACAGAAAAAAAGGAAGGAAAAAGAGGGGGAAATAAATAAATGTGA AACAATCAATAAATTTCGGAAAACAATTGAATTGTTAATGACGGATCATAATGATATTGATATCGCTTTTAAAATTGATC AATCTGATTACAAGATTTGTTCTCTTTTTTTTTAAAAAAAAGAGAGGAAACAATAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_542: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190551126942N21772SMNHADA018020SKSmAW
9100911906156AA269059MA1MA059.AA3S. mansoni adult Lambda Zap


Date: 7:30:7 on Sat 18 Nov 117.