CShisMan2_544


Sequence

>CShisMan2_544 (2 EST) Length=429 AAATTTCTTTTTTATACTTCACAGCTCTGTTGCTTTTTGAAATGTCCCATGGCAACAACTTTACTTCAGCTATCTCTCCT CTCTTGTGAATGTAAATACATGCGTTTACATAGGATATAGTCATAATGATGTTGGTCAAATTGTATAAATCACTCATATG TGTTTGACTTTTGTAATATGCTGACGGAATTTTGTCTTTNCCTATATGCATATATGCATTGTTATTACATCAGTCTTTTG TCTAATACTCATCCTTAATTTATTATTTATTTATTTGAACACATCAATATTGGTACAAAGGGGCACCGAATACATATGCG CCGCACAAATCTTATTTGATTTGTGTGAGGGCTGTGATACTGCCCAGATCCCAAACTGAAGCAGGTGTCATCCTTAATAT GTATGTGATGTATGATATTTAGGAGTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_544: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695093509910AI110940MF002H04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695793509980AI111010MF002B03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 21:17:21 on Sun 19 Nov 117.