CShisMan2_550


Sequence

>CShisMan2_550 (25 EST) Length=1206 ACTCTAAAGAAATTTTATAAAGTATCAAAATGCATATTTGATTACGTAAAAAGTCAAACCATACAGCACCAGATATCCAC ACAAGATGACAGAAGAATGCACATTCTACAGGAAAGTGTTTCACCAATGGCTGACGAGTCAGATCTCTGACTTTTTCAAA TGGTCTGAACCTTCAAGCGATTGGCAGACGGAAGTAAGTAGATATGAAACGGTAGGAAAGTAATCAAGTTCAGATGGAAA GCCCATTTAGGCAAGAAATGCATCGAAGAGCGCAGAAAGCTAAGGCTGTAAGATCGAATGAAACATTTTGAACATTCCCA CAGGAACTCTGGATTCAAAAATTTGAGACACAAGTTTGACCAGTTAGACGTCGAAACTGATGGAAGGGAAAAAGATGGTG TACATCCGAAATACCATAAAGACAAGTGACAATCCAGTGTGCTGCAAGTTGGATGATTAAACAATTGAGTTGAAACGTAG ACATGCATATATAGATGCTGACAGAATACACAGATTTCTAAAATGACGTTTCTCAGTATTTGATCAGAGAATTTTAAGCG TCTCGCATATCCGGTGAGCCATCCCCGTTATGATAATTATCCCTTCCCCCACGAGGGCCGCCACGACCTCGAGACTCGAA CCCACCGGATCCTCTAAACCCACGACCACGAGGCCTTCCACGTCCCCGGAACCCACGGCCTCTCCCACCGCGATCCATAA ATTCGTAAGCACCTCCGTACATTTCTGAGCCCCCACGGCCGCGGCCTCGACCTCGAGGACCGTAGTAAGGCACGAAATCT TGATTGCTGGAGAATCCGCCAGGTCCCATTCCGCGGCCTCTCCCACGCATGTTAAATACCCGCGGGCTGCGTCCACGTCC ACGCAAAGCTGCGTACACACTGCCCTTAACAGGCTCACCCCCAGGGCCTGTCACTTCGGATGCTTCGTCACCTTTGTCTC CTTCAACAACATAAAACTCCACCTCTTCTCCCTCCTGAAGTGAGCGTTGGAGCTTCTCTGGATTGTTACGTGATATTGCT GACTGGTGTACAAATATGTCCGTGGATGTGTCCTGACGGTTGATGAAGCCATATCCAGCCTTCACATTGAACCACTTAAC CACGCCTTTGACACGCTCTCTCGTGCACCTTGCGTGGCNCGTTTTGTTTCTGCTGTTCATCTTTTTCAGCTGGTCTAGTG NCCGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_550: (25 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39115514509T14342SMEST0003Schistosoma mansoni, adult worm, Gloria Franco
39116514510T14343SMEST0004Schistosoma mansoni, adult worm, Gloria Franco
39149514543T14376SMEST0037Schistosoma mansoni, adult worm, Gloria Franco
39150514544T14377SMEST0038Schistosoma mansoni, adult worm, Gloria Franco
39202514596T14429SMEST0090Schistosoma mansoni, adult worm, Gloria Franco
39344514738T14571SMEST0232Schistosoma mansoni, adult worm, Gloria Franco
344924975980R95610SMNHADA017062SKSmAW
5137001444953W06733SMEST0369Schistosoma mansoni, adult worm, Gloria Franco
15130282854308AA791353SMTBADA000843SKSchistosoma Lambda Zap II
17370033189923AA999368MCCE3208.M1FSchistosoma mansoni, cercariae
17370743189994AA999439MCCE3296.M1FSchistosoma mansoni, cercariae
17371073190027AA999472MCCE3344.M1FSchistosoma mansoni, cercariae
17581253233304AI018968SMEST0608Schistosoma mansoni, adult worm, Gloria Franco
17581313233310AI018974SMEST0614Schistosoma mansoni, adult worm, Gloria Franco
17581333233312AI018976SMEST0616Schistosoma mansoni, adult worm, Gloria Franco
17581373233316AI018980SMEST0620Schistosoma mansoni, adult worm, Gloria Franco
17581423233321AI018985SMEST0625Schistosoma mansoni, adult worm, Gloria Franco
17581463233325AI018989SMEST0629Schistosoma mansoni, adult worm, Gloria Franco
17581553233334AI018998SMEST0638Schistosoma mansoni, adult worm, Gloria Franco
17581573233336AI019000SMEST0640Schistosoma mansoni, adult worm, Gloria Franco
17581703233349AI019013SMEST0653Schistosoma mansoni, adult worm, Gloria Franco
18148183385178AI067211EST208885Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152063385566AI067599EST209281Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153813385741AI067774EST209458Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157593386119AI068152EST209843Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:55:51 on Sat 18 Nov 117.