CShisMan2_555


Sequence

>CShisMan2_555 (3 EST) Length=651 AAGAAAAAGAGAAGTGATATTTATTTCCTTAGCAAATGTGATTTGCATAGCATGAGTCGGTGTCAGTTTAAACCCTTCAT AAGCAGATCGCGCAGCAGCAGCTTGTGATTCAGTATCATATTCGACCAAAGCCAACTCCACCAGCAGCACGTCTAGCCTC TTTGAATCCCGAGAATTGACTAAATAACATTGTAAGCATAGCATCAGTAGTTTNCTTCTGGTAAATTACTAACAAATAAA ATATGATTTGGTTGATCTAACAATGCATTGATATCTCCACCGGTACCCGCTGGACCATTTACTGATTGATTAGCTGCTTG TAAAGCCCGCCTGCTGCAGCTGCAAGCACGTTGTGCCCATTTTCTTTCGTCTACGGTTTTTCACGGTCTTCTTCACGTCT CTTTTGAACTTCAGCACTGACACCTTTCAAACAGATAATCTGTTGCGAATCTTTTTTAGCATAAGTTACTCGCATAGGTC GTTGAAATAATTGAAATCCTTGTAATGAACGATAAGCTTGCGTGCACAAGCAATATCCTGATAAATAANAAATGCCTGNC CACGNATTTTCATTGTTTTCATAGCTATAATATCAATTAGTCGACCATGTTGNCCNAATATATAATATAGTGCTTTTTTC AAATCGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_555: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39232514626T14459SMEST0120Schistosoma mansoni, adult worm, Gloria Franco
39233514627T14460SMEST0121Schistosoma mansoni, adult worm, Gloria Franco
345035981302R95642SMNHADA019088SKSmAW


Date: 7:6:59 on Mon 20 Nov 117.