CShisMan2_559


Sequence

>CShisMan2_559 (2 EST) Length=653 TAAATGCCAATTAACCCATTTGTTGAAGAGTCATGACTAGTGATCACTTCATTGGTTGTTAATTCCTGGTTGNANTTTCT TGGCTAACACTTTTCCCAGTTCCCACACCCCATTGATCCAAGGAANTAATATTCCATATAATTCCCTGANCAAATATCTT ATGTTCATACATAGCAATCNAAGCACCCAANATATATGGTGTCAATTTGGTGAACACAATGGAATTAGATGGACGATTAC CTTTGAAACTTTTATGCAATGCAAGTGAATTTAACATGTCACCAGTAACTCCAGCAGCAANCAATTCCTTATGAACTTCT TCTTTTGTCTTGCCAGTCATTAAAGCTTCAGTTTGAGCCCAAAAAATTAGATAGGAGAATTCTCATGATGTAAGCCACCT TGAACTGGATTGTGTGTATGAACTGGTATCAAGAAATCACATGGGATTAAGCGTGTGCCTTGATGGATAAGTTGATAAAA TGCATGTTGACCATTTGTTCCTGGTTCACCCCAAACTATGGGACCAGTGGNATAATCAACTTNTTTGCCATCACGTNTAA CAAACTTCCCATTTGATTCCATATCACCTTGTTGAAAATATGCAGCAAAGCGTGACATATATTGATCATATGGTAGAATT GCTTGAGTTTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_559: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344855975911R95541SMNHADA002011SKSmAW
12100362330325AA559629MC090719.NA3TBRI-Saber-cercaria-A


Date: 4:23:20 on Mon 20 Nov 117.