CShisMan2_56


Sequence

>CShisMan2_56 (6 EST) Length=634 GCACGAGCAGCGCGCTATTGGGAATTACGAAATTAAGCAATGTTGGCCGACGGTGTCACTCCAGGTAAAATGGCTTGTTC AGACGGTTGCCCCATGGCGGAGAAAGTACGCTCCATAGTGTACTGGAGGCAACCAATTGTAACAGGAGTCATATTAACTC TCTTGCTGATTGTCGAATTTAGTTTTATGTGTCTTTCTGCGATCTCCTTCATTGCTTATATTGGTTTAGCCCTTCTTGTT TCCGTCAACTTATTGCGTATGTATTATCACTTTGTGGCTAAAACAGAAAATAATTTTGTCAGAGAATATCTAGAACGAGA AATCACTGTGCCACAAGATAAAGCAGAGAAAGTTTCTCGACGTCTCACTGAGGTTTTAAACAAAGGGTTAATACGCACTA GAGAAATATTCTTACTCACTGACCCCGCCGCATCCGTAAAATTCGCTGTACTGTTATATCTACTGACATACATTGGTGCC CAGTTCAACTTCTTAACTTTATGCATACTATTTACTTTTGGTGTCTTTTGTGTGCCGAAGTTTTATGAGCGCTACCAACC GGAAATCGATAAAATGATTGAGCTGGCGAAATCAAAAATACATATGGTATCATCACAGTTTAAAACGCATCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_56: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621731196840L76102SCMRAP0187tcz2/KS adult worm mini-library
18146653385025AI067058EST208727Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146763385036AI067069EST208739Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151723385532AI067565EST209247Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152483385608AI067641EST209324Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155183385878AI067911EST209599Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:53:7 on Thu 23 Nov 117.