CShisMan2_567


Sequence

>CShisMan2_567 (2 EST) Length=428 GCACGAGTTACAACCATTTATTATTAATTTCATGTAGATATGGAGAGAAGACCATCAGGATTTTCAAAAATACCACCAAT TGGTTCAAGATCTGTTCTAATTGCTATCGATGGATCAGAACATTCAAAAAAAGCATTTGATTATTATTTAAAATGGTTAC AAAGACCAGATGATTCTGTGACAATCTATCATGCCGTGGGTCCTGTCTCATTACCAACTATATCATTATCTAATCCAATT AGGTATACCAAGTGAAGAATGGTCAAATCTTGTACAAACAAATGTTAAACGTGTACGTGCAATTAGAAAATGATTATAGT GGCCGACTGGTTCAGCACATAATTTAACATATCAATTTTTATATGAATCAGTAGATCATATTGGTGCAGCTATTGGTACA AAATGCTGAAAAATATAATGTACATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_567: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190321126919N21749SMNHADA017040SKSmAW
11529332245768AA508328MAAD0409.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 1:34:40 on Sun 19 Nov 117.