CShisMan2_570


Sequence

>CShisMan2_570 (11 EST) Length=563 AGTTATAAGATAAGTATATTAGGAACGAGTAACAACCAGAAACATAACACTCAAAAGAAATGAAACCTAATACTCTTCAC CTTCCCCTTCGCCCTCGCCATCAACGCTGTCAACACCGACCTCCTCGTAATCTTTCTCAAGTGCGGCCAGATCTTCACGA GCCTCAGAGAATTCACCCTCTTCCATACCTTCACCAACATACCAGTGTACAAACGCACGTTTTGCGTACATCAAATCAAA TTTATGATCTAGACGCGCCCAAGCTTCGGCTATTGCGGTTGTATTACTCAACATACAGACAGCACGTTGAACTTTTGCCA AATCACCGCCAGGAACAACTGTTGGTGGTTGGTAGTTTATACCTACCTTGAAACCTGTTGGACACCAATCCACAAACTGG ATAGTACGTTTAGTTTTTATTGTTGCTATGGCAGCGTTGACATCCTTGGGGACAACATCACCACGATATAACATACAGCA CGCCATATATTTGCCGTGACGAGGGTCACATTTCACCATCTGATTTGCTGGTTCGAAGCATGCATTTGTGATTTCTGCAA CGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_570: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39304514698T14531SMEST0192Schistosoma mansoni, adult worm, Gloria Franco
5137041444957W06737SMEST0373Schistosoma mansoni, adult worm, Gloria Franco
5137431444996W06776SMEST0412Schistosoma mansoni, adult worm, Gloria Franco
7641751685491AA125672MLLG0210.M1FSchistosoma mansoni, lung stage
7791171702776AA140633MEEG0201.M1FSchistosoma mansoni, egg stage
8577881832548AA218455MAAD0110.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578541832614AA218521MAAD0209.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
17370003189920AA999365MCCE3205.M1FSchistosoma mansoni, cercariae
17370313189951AA999396MCCE3245.M1FSchistosoma mansoni, cercariae
17581343233313AI018977SMEST0617Schistosoma mansoni, adult worm, Gloria Franco
18147653385125AI067158EST208829Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:9:34 on Thu 23 Nov 117.