CShisMan2_571


Sequence

>CShisMan2_571 (7 EST) Length=999 ATTCTTACTAAGAATTTATTCAGTAATAGATGAAGCACAAAAGTTGAAAATAATTACAAATATAACCGGGCATTATTTAG ACCAGTTGAATGGACCTGGACCAGGGAGGATTTTACCAACAACACCATAACCAATAGTAGAGGAATCAGCCCGAATAGTA AAACGCTGTCCGACCTCAAGAGCCATTTTCCTATGGAAGTGTAGGTTCACAGCTGCATCTTCCCCTGGCATAACCATCTC CCTTCCTTCAGGGAGTATTAGAATAGCAGGACAATCCCATGATTTACTGAAAACATGGAACTGATGATTGTCCGTAAATG GTTTACTACGACCACCTTCTTTCTTCGAAAGCATATATACCTGACACTGAACATAGTCATGTATTGACATAGACTTTGGT TCTAAAAAAAACTGGACCACGTCTTACTTCATCTCGTTTCACTCCTCTCATTAAGATGCCAACTTGGTCACCTGGTTCTG CTTGATCCAAAAGTTGGTGAAACATTTCAATCCCTGTGACAGTGGATTTTAAAGTCTGACTATATCCGATTATTTCAATT GGTGACTGAAGCTTAAGAATTCCACGTTCTATCCGACCTGTAACAACAGTACCTCGACCAGTAATGGTAAATACATGTTC GATAGGAAGTAGGAAAGGTTTATCTTTTTCGCGTTTCGGCAAAGGAACTGAATCAATCGCATCAAGCAATTCTTCAATTT TCTCAATACCAAGTTTAGGTTCGCGATTTTCCAGTGCACAAAGGGCAGAACCACTGATAATTGGTGTATTATCTCCATCA AATCCATAATGTTTTAATGTATCTCTGATTTCAAGTTCAACCAGTTCTAGCATCTCTGGGTCTGCCGCATCAGCTTTATT GATAAAAACAACTAATCTTTCTATTCCTATCTGTTTAGCCAATAATAAATGCTCTCTAGTCTGTGGCATAGTGCCATCAG TTGCTGCTACGACGAGAATAGCGCATTCCATCCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_571: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369233189843AA999288MCCE3097.M1FSchistosoma mansoni, cercariae
18147113385071AI067104EST208774Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147313385091AI067124EST208794Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148893385249AI067282EST208959Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149023385262AI067295EST208973Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154863385846AI067879EST209566Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156753386035AI068068EST209757Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:59:41 on Tue 21 Nov 117.