CShisMan2_574


Sequence

>CShisMan2_574 (2 EST) Length=422 GGTTTACAGAAGCAATTAAGCTAAACCCACAGTCCTCACTGTTTCATGCCCGACGTGCAAGGTAAATACCATTGTATCTA GCAATTCCACAGTTGCTTTGTACGAATGAAAAAGCCGTCCCATGCTATTGCAGATTGTGATAAAGCTATTTCGTTAAACC CCGATTCTGCACAACCTTACAAATGGAGAGGATTTGCTAATAAAATGATAGGTAATTGGGAAGCCGCCTATCAGGATCTA CAGACATCTTTGAAGCTAGACTATACAGATGATGCCAATGAAGCAATAAAGGAAATCGAACCAAAGGTAATTCCTCGTAA TTGGATACTTATAGGTACGCATATCACTAATGTTTTTACTCATGAACTGCTTCGTGAGACGTAAAAATTATCACTGTTTA CAATGAAATGAGCATTAGTCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_574: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147013385061AI067094EST208764Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150843385444AI067477EST209159Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:54:58 on Tue 21 Nov 117.