CShisMan2_576


Sequence

>CShisMan2_576 (2 EST) Length=700 GAGAACATCTGCAGCATGGGTATTGCTCGAGATCGCATTCATAAAAAGGCTAAGACTGGGGCTCGCAGAGAGCGAAATCT CAAAAAGAGGAAGTTCGAGTTAGGACGTCCAGCAGCAATGACAAAGCTTGGACCTAAACGTGTCCACACAGTTCGTGTTC GAGGTGGGAATCTTAAGTTACGTGCAATGCGTCTGGATCAAGGAAATTTTAGTTGGCCTTCTCAAGCTATCTCACGGAAA ACTATAATAATTGATGTTGTCTATAATGCTTCTAGTAATGAACTTGTCCGAACAAAAACTCTTGTTAAGAGAGCAATAGT TCACATCGACGGAGCCCCATTCAGACAATGGTTTGAAGCTCACTATTTGAGAGAACTCCGTCGCACGTAGAAGTCGTTAG CAAGAAAGGACATACAGTTACACAGGAAAATCCAGAGGAAGATGTTTTGTTGAAGAAACGCAGCAAGTCCGCCTTGAAAA AGTATGAAACTCGTCAGGCTTTGCCTCAAGCAAACGTAGAAGAGCCTTTAAAAGAAGCATTTGTTACAGGTCGTCTGTTA GCTTGTATATCCTCTAGACCTGGTCAAATCGGTCGAGCAGATGGTTATATTCTCGAAGGCAAAGAGTTGGAGTTTTATTC AAAGAAACTAAAAGTTAAAAAAGCAAAATAAATTTCTTTGAAAATAAACTTTTCTANGGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_576: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529222245757AA508317MAAD0426.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18151823385542AI067575EST209257Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:42:41 on Tue 21 Nov 117.