CShisMan2_578


Sequence

>CShisMan2_578 (4 EST) Length=420 GGTTGTGGCAAAAATGGCGAATCGTTGGGGCCGAAATGCACCTTATGGTGGAGCAGGCGGTGGCGGCAGTGGTTACATGG GTTCTGGGGTTGTTGGTGTAGGCTTCTATATGGGTGGGCCTACCCCAAATGATCGCAGACCTTATAACGCTGCCCCGGTT GCTAAGCCGTTTTACGGTGGATACCGAGAAGATAACTACAACAGACGATCAGATCGACGAGATGATTTCCGTGGTGGTAA GCGTGGTCAGCCAAAAGGGCGAAGTCCGGAGAAACGTTACCATGATACACCACCTAGCCAACGTAAAGACCACAGAGCTT TCGGGAAACGCCAGTCGTCATTTTCACGTTACGAAGTGAAGATCCCCAAAAGGTTGTTCAATGTGTCTTCATCGTCCTTA CCTGATCTTCGACATCGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_578: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146803385040AI067073EST208743Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148983385258AI067291EST208968Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152653385625AI067658EST209341Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156563386016AI068049EST209738Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:21:9 on Sun 19 Nov 117.