CShisMan2_58


Sequence

>CShisMan2_58 (2 EST) Length=643 AGTTTCTGAGTTCCTTGTCTTATGTATTTATGTAATTGATTTTCGACTTGTAAAGCCAAATAACTATTAAGGATATTTGA CACTTCTTACGTAGAGGACCAAGAAAGTGACTAACACGACTAACTATGCGAAGCTAGAAAGTTACTTATAGCCTGTTGTG TATTAGTGTCTTGACTAACGTGCTTTATTTCGATTTTTATTTAACAGCTCCTGCGGAGATGCGTTTAAAAGAAAGGCGTG ACGAGCCTCACCGCGGTGGAAGAAAGTATCGTTCGAGATCCCGTTCCAGGTCTTACTCCAATTCTAGACAAAAGGGGGTC GAACCGTACTATCGTGGTCGCCCTAACGACCGCCGAGATGATTCACGAAGGCGAATAAATAATGTGCGCCCCAATCGATC GGCTTCAAGATCAAGGTCTCCCACCAGGTCACGGTCGGCCAAGTCATGACGGCATGGATAATGGTGATGAAGTACGCAAA GGTAGTCGACGCAATGATCGTAGAGACAACCGTGCTGTCTCCAGAAGTCCTGCACATAGGCGTGGTTCTTTATCACGATC TCGTTCCGGTTCATACTAATGTACATTTGTTAAATTCAACCATTTCATTCATCTTTGCATTTTTAATAAACGTTTATGTA AAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_58: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641441685460AA125708MLLG0130.M1FSchistosoma mansoni, lung stage
18155063385866AI067899EST209586Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:17:59 on Mon 20 Nov 117.