CShisMan2_581


Sequence

>CShisMan2_581 (4 EST) Length=681 TCACCTCACTAAACATATACAATATATGTGATGTCTCGGTTCAGTAAACAATGCATTTTATCCAGTTACCGTCTATATGA TCATAATGTAAAGTACTTAATAATATCACAATCGANTTGGGGCTATAGCTCACAAAATTGGCTAGTTTATTTTTAANGCT ATTTTTTCGATTTCATTGGACCCTTTATCAGCAAGATTACACTGAATCTCTTTTTCCTTGAAACTTTAGAGAATAGAGAC ATACCTATGACTTTATATAGAAACATTTATCTTTCATAATTTTGATTCAGAAAAATTAAATCACACCCAATTATTTTTGT TTCTGTATTATTAAAACTTCTATTTCATTTATTAAACATATATATGTTCATATATATATATATATATATATATATATATA TATATATACTGGAAGTTGACAATAACCGCTAGTATCCAAAGGTTTGNTGAATAAATTTCGATAAAATCACTCCCTTTCAT TTTGNTTATTGCTTCTTGGTTTACCGTATGACAGCTAGTCNANNAATTATACGANAAGAAGCCAACTAGAAATCATTTTC TGAGGNCAAAACGTNAGGTCACACACAAAAGACCCGTTGTGCAAATCTAATTATCCAAGCTACGTTAAATTAAGAAGATA ANNAAAGNCNAAATAATTCCTTTAAGTTACAGAANTGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_581: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344923975979R95609SMNHADA017060SKSmAW
345013981280R95620SMNHADA017037SKSmAW
17371733190093AA999538MCCE3455.M1FSchistosoma mansoni, cercariae
17372493190169AA999614MCCE3586.M1FSchistosoma mansoni, cercariae


Date: 6:4:56 on Sun 19 Nov 117.