CShisMan2_597


Sequence

>CShisMan2_597 (4 EST) Length=430 AGTCTTGAACGTGCACACCAGTAGAGCAGTTTCTCGTTTTACCACTTTGATCCTTTTTTCCAAATTATTGCCAAGTTCTC TTAATATGCTGGTTCTCATACTGTCATGGTTATGTTCATTTAGGTAGTCATTGTTTATCATCTTTAACTATATTATATAC TCTAAAACTTGACGTTTTACCAATATCTGTCCTTGATTTGACAGATACTTCATGTTGTTTGAGGCTGTTCTTCATACTGA GAATCTAAGCATGTAATATTTTGTTCGGGTTATCATGTAATGCTTTGATCCACAACCTCATAAAGAAGGTTTTGCGCATA TTTTATTTCAGTTTGAAAAAAACGTATATGACATCATTTTGCTTTGTATTCTTCCAAAACTAAGTTAATCACTTGGTCTA TAAATCTGTCAAATATAATCAGTTATTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_597: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190531126940N21770SMNHADA018012SKSmAW
5137421444995W06775SMEST0411Schistosoma mansoni, adult worm, Gloria Franco
5137571445010W06790SMEST0426Schistosoma mansoni, adult worm, Gloria Franco
7807881705383N20717SMNHADA002044SKSmAW


Date: 4:31:40 on Thu 23 Nov 117.