CShisMan2_60


Sequence

>CShisMan2_60 (6 EST) Length=1261 GACGTGCTAGTACAGTGTGAAACTTTGGATGACTTAAAGCTTCACCTGCATGACACTGACTATGGGGAATTTCTCGCCAA TGAACCGGGACCTTTGACTGTGGGGATCATTGAAGAGAGAATTCGCGAAAAGTTTGTGTCTGAGTTCCGCCACATACGCA ACCAAGCTGTATACCCATTATCTTTATTCTTGGATTACATCACATACAGCTACATGATTGATAATATTGTGCTTCTGATA ACAGGGACTCTTCATGGCCGGCCGATATCCGAACTTATGACTAAATGCCACCCTCTTGGGACATTTTTGGAAATGGAAAC CCTGAATATTGCAACTAACCCTGCTGAATTATACAATGCTGTACTCGTGGATACGCCTTTAGCTCCATTCTTTATTGATT GCATTTCGGAGCATGACTTAGATGAACTTAATATAGAGATAATACGTAACACTTTGTACAGGGCATATATTGAAGATTTT TATGCCTTCTGTAAATCACTGGGTGGAATCACCGCACGAGGTGATGTGTGAGTTGTTGGCTTTTGAAGCTGATAGGAGGG CGTTTATCATAACAATCAATTCATTCGGGACAGAACTTTCGAACGAAGATCGGTCCAAACTTTATCCTCGCTGTGGAAAA CTTAACCCAGAGGGGCTTGTTCAACTTGCTAAGGCTAACGATTACGAACAAGTAAAATCCGTTGCCAGGTACTATTCGAA TTATTCCTCTTTGTTTGAAGAAACTGGTGAGGGCTTTGGGGATAAGACATTAGAAGATAAATTCTTTGAATATGAAGTTC AATTGAATGTAGACGCCTTCTTACAGCAGTTCCATTATGGTATATTCTACGCCCTTCTTAAATTAAAGGAACAAGAAATG AGAAATATCGTTTGGATTGCGGAGTGCGTTTCCCAACGTCATCGTACCAAAATTGACTCTTATATCAATATTTTATGACC TGAATATGACGTTTTGTTGAAAAATTATTCCACGCTTAAAATGCGTTCTAAGCATAATGTTTTTGACTGTTATAGCTTAC TTTGGATTTATTTATTTATTTAAACTCGTGAAAAATTTATATAATTTATTTTTTCTGTATGATTAATTTCAAGTGATTAT TAAAACGGTTTTAGTCGTCCGAATCACTAATATCAATTTTGAGATTTCCTTTCGTAAATATCATTTTAGATGCTTCCATT CTTTCTCCTAACACCTGATTTTTTGTTAATGTTGTGTTGGAATATCAATAAACTATGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_60: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137401444993W06773SMEST0409Schistosoma mansoni, adult worm, Gloria Franco
18149193385279AI067312EST208990Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149363385296AI067329EST209007Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149683385328AI067361EST209039Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155433385903AI067936EST209624Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155603385920AI067953EST209642Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:1:48 on Tue 21 Nov 117.