CShisMan2_600


Sequence

>CShisMan2_600 (32 EST) Length=678 GACGAGTTTCTTTAGCACGAGATTTAGTATTATTTTTTGCGGTGCTTCCTTGCATATTTTTTTATCATCCGTTTATTATG ACAGTTGTTTTGTGTGTATGAGTTTACTTGTTTCGCAAGTATGTAGTTTGAGATATATTTATGTTACGGATTAGTTGTAA GATGGCGTTTTGGTTGTTTTTAGCTAGGGAGTTAATTGTTTTTCTTACTATAATTTTTTGTTGTTTTTGGTATATTAAGG GTTCTAGCGTTGCAATTTCTTATCCATTAGGTATTCCTATTCTAGAAACCTACTTGTTGATAATGTCTTCTTTTTTTATT TCTGCTTTTCATAGAAATTTGGCTAGTGTAAAAGGTCGTATCTTTGTTTATTTATCACTTGTTTGTTCCTTATTATTTAT TTTTTTTGCTGTGGATGAATTTTTGAATAGTGTAGTTAATTCTTTGTGTGATCCATATTATGCGAGTTGTTTTATGTTGG TTGGATTACATCTCAGGCATGTTATTTTAGGTAGGTTTGGTTTATATGAGTTATCAGGTTTTCAGTTGTCTAGATTTATT CGTTGGAAGAATAAAATGTTAATAGTGTATTGACATTTTGTTGATTATATATGACTCTTGGTTTATTTAGTAGTATATAT AGTTCATTTGTAGCTTAATGTATGATTTAATTTGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_600: (32 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1068964
39299514693T14526SMEST0187Schistosoma mansoni, adult worm, Gloria Franco
344645975510R95401SMNHADA009005SKSmAW
344869975925R95555SMNHADA007059SKSmAW
344882975938R95568SMNHADA008016SKSmAW
4191301127981N21848SMNHADA018072SKSmAW
4192181128069N21936SMNHADA020042SKSmAW
4350691154093N33694SMNHADA018064SKSmAW
4350721154096N33697SMNHADA018088SKSmAW
7791001702759AA140599MEEG0136.M1FSchistosoma mansoni, egg stage
7823951713233AA143828MCCE0129.M1FSchistosoma mansoni, cercariae
8577951832555AA218462MAAD0120.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578001832560AA218467MAAD0126.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578511832611AA218518MAAD0204.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529292245764AA508324MAAD0414.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12100092330298AA559602MC080534.NA3TBRI-Saber-cercaria-A
12184932341109AA568097MU000001.Y2FSmL
14785982804094AA756924MF4MA166.AF3S. mansoni female adult Lambda Zap
17369683189888AA999333MCCE3153.M1FSchistosoma mansoni, cercariae
17372583190178AA999623MCCE3608.M1FSchistosoma mansoni, cercariae
17372683190188AA999633MCCE3646.M1FSchistosoma mansoni, cercariae
17653973241804AI026190MEEG0426.M1FSchistosoma mansoni, egg stage
18150453385405AI067438EST209120Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151233385483AI067516EST209198Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153193385679AI067712EST209395Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153583385718AI067751EST209434Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154453385805AI067838EST209522Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154763385836AI067869EST209553Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154893385849AI067882EST209569Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156043385964AI067997EST209686Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158303386190AI068223EST209914Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159533386313AI068346EST210037Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:50:19 on Sat 18 Nov 117.