CShisMan2_601


Sequence

>CShisMan2_601 (8 EST) Length=514 CAGCCCCTTATCACCTTAACCAACTAGTACACCATATAGACTTGACTACCTCAGTCCTAACCACTCACTTAATTAAATAT AACTGCTCCAAAAAACAATAAATGAACCATCCTACCAACACATAAACCTAGAACCAACCATAAAATAACTAAAAATAACC TTATACCAAAACCTAAAACTTAACGGAAAAGAAATCAATCATAGCANATACCTAAACATACAAAAAGACTTACTGAAATA CACTAACACACCAGTCGCCCAAAATGAATAATATACCAAAATCAAACAGAAAGCATCAACCCCTACCAACCNAAGTATAT ATATCAACAGACAACTTGATCTAACAGTCATGTGACACCAAATAATAAATCATCTACTACTGTTAACCCCAAAACTTAAC CCACTAAATAAAAGCCCCAGAAACACACATAACATCCAAATCCAACTATNAAATCTACATACCAAATACCCCACTCCAAC TAAAACAACCTTCATCAACCTCGTTCCGAATNGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_601: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156941122637H98416SMNHADA016076T3SmAW
4189901126877N21707SMNHADA009077SKSmAW
4192001128051N21918SMNHADA020007SKSmAW
7641461685462AA125710MLLG0132.M1FSchistosoma mansoni, lung stage
9101861906251AA269183MA1MR006.AA3S. mansoni adult Lambda Zap
15233712870773AA801601SMTBADA000726SKSchistosoma Lambda Zap II
17372053190125AA999570MCCE3500.M1FSchistosoma mansoni, cercariae
18159473386307AI068340EST210031Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 5:58:39 on Wed 22 Nov 117.