CShisMan2_602


Sequence

>CShisMan2_602 (5 EST) Length=463 CTTGTTTAAACAATAACTAAACAAATATCATTGTAATTCATCAACTTCAATCATTGCTCATTATGCAAAATCAGTGACCA ATATATTTTCGTTTGTTTTGTTCATATTCAATAAAAATTACCTGTCTATTGGAAAATATTTCTCATCATACAAATGAATA GAGAATTTGTTTGTTATATTCGATTATTAATTGGCATATATCGTTTATTCTTGTTTTGTTCTCAATCTTTTTCGTGATAC ATTTGATATGTACACTATCTCTCCCTCCTCTAAATAAACAAATATCTTACTAGGAAATTCAGTAGGCGGAAATTAATTGT CGTNTTGGTTATCAACTTTTTAATCTATGACACACTAATCACTACATTCAGTAAAATTGGTTTTAAAGGAGAACAAGTAA ATAAGTGTGATGTTCATGTGTTTATGTGTTCTGTATTCGTTATATTCTTAATTGAAAGTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_602: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191481127999N21866SMNHADA019009SKSmAW
16629223080347AA931038SMTBADA000215SKSchistosoma Lambda Zap II
18695113509912AI110942MF002H02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695643509965AI110995MF002C09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695903509991AI111021MF002A04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 9:9:53 on Sat 18 Nov 117.