CShisMan2_604


Sequence

>CShisMan2_604 (2 EST) Length=529 GTTTGAAAACGCACTGACTTATTTACCTTGCCTCTAAATAGAGTTTTGGCATAAAAGCTGATACCTTGTGATATCCTCAA AAAGTGTAATGAAGCTGGCATTTGTAACTGGGTCAAACAAGGGCATTGGATATAGCATTGTTGAAAAGAATTCGGCACCA NGTTTTACGGAGCATCAGGAGAGTGGGATATTTATCTAACAGCTCGCAATGTTGAGCTTGGTCAGGNAAGCTGTGAAAAA GCTCAGTAACAAGGGTTTGGATGTTAAATTCCATCAACTAGATATAACGGATCAAAATAGTCGAAAAGTGTTCCTAACAT TTGTAGAGAGAAACTATCCTAATGGAAATCAACATTGCAGTGAAACAATGCTGGAAATTGCCTACAAGGGCTAACTCCGC GGCTCCCTTTGGGCGAACAAGCACGAGTTACGGTGAAACACCAACTTTACATCAACTATTGAATTTCATGGAGGAGTTCA TCCCTTTGCTGGGCTAAACATGCTAGGGTTGTCCACTGTATCTAATTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_604: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39332514726T14559SMEST0220Schistosoma mansoni, adult worm, Gloria Franco
12097572330046AA559841MU001047.NH3York-Harrop-lung-A


Date: 2:44:12 on Mon 20 Nov 117.