CShisMan2_607


Sequence

>CShisMan2_607 (3 EST) Length=419 GGTCTTCTGCCGCGCAGTTTCGAATTTCCTGTTCCTCAGCTGTACAAATGGCATTGAGACGTATATCCAAAGAGTTACAG GACTTAAGTGTAGATCCTCCAACCCAGTGTTCAGCTGGACCTATTCACGATGATCTATTTGCCTGGCAAGCCACTATTAT GGGACCTGTATGTTCGTTTATTCTGTCATAATATACCCGTAGGCTGATAGTCCATATGAAGGTGGAGTCTTTTCCCTGAA AATACTATTTCCCACAGATTATCCTTTCAAACCCCCTAAGATCAGTTTCATGACGAAGATATATCATCCGAATATAAATC CCAGTGGTAGTATCTGCTTAGATATCCTCCGGGGTCAGTGGTCTCCTGCCCTCACAATATCGAAAGTTCTACTTTCAATT TGTTCATTAGTGACGGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_607: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785922804088AA756918MF4MA160.AF3S. mansoni female adult Lambda Zap
18146573385017AI067050EST208719Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150963385456AI067489EST209171Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:43:39 on Fri 24 Nov 117.