CShisMan2_61


Sequence

>CShisMan2_61 (18 EST) Length=642 CTTTTAAATCATTAGATTGATTTGGATTGTATGTCGATAGGTTTACTTGGTTTGGTCCTGAAGAGTCCAATAACTGAGAA TCAACAGAAAGACCCCTGTGTCTGAAAAATCTGCCATCCGGAAGCAGTCTACAGGCAAGTAAATCAGATTCAGTTGGCAA CCCGTTCTCGAAAATAACAGGCTGTATCCGAATAAGATGTTTTATCTCGTATAAATCTCGGTTGACTGACGGAGTATTTT TGACAACTATCCAATTGTGATTTTTGTGTCCTTTCCAAGACCATATTTTTCAAGAATAGCTCTCTGGTAGTGAATGATTC CCTTGAGAGGCTTTAGCCGACAGACCATATGCAGTAAAGGAGGTTCCTTCGCTTGGTTGAGCAATGGTTGAGATTCTTGC AGTTGGAATAGACGTTTGGCCCATCTCAATGGATTTTTTTCCTCATCACTCCCAGGAAGTGGTTTTGATTCCTTCGTATA TGACATGGCGTTGTGAGGTAAAGAAACATGAAGCGATCGACAACTGGTCATCAAATTAAAAGCCCAAGGTCGGGTCATTA TAAGGAGGTAAGTTTTTTCTGAATGTATGGTCGTTTGAGCAGTACGACCTCTTAAAGTTTGGTACTAGACCTTCACTCGT GC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_61: (18 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147033385063AI067096EST208766Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147783385138AI067171EST208843Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148483385208AI067241EST208915Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149433385303AI067336EST209014Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149723385332AI067365EST209044Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149943385354AI067387EST209068Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150953385455AI067488EST209170Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151223385482AI067515EST209197Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152953385655AI067688EST209371Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155233385883AI067916EST209604Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155913385951AI067984EST209673Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156073385967AI068000EST209689Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156513386011AI068044EST209733Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156633386023AI068056EST209745Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156733386033AI068066EST209755Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157103386070AI068103EST209793Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157363386096AI068129EST209819Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159063386266AI068299EST209990Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:27:52 on Thu 23 Nov 117.